neb buffer 4 (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs neb buffer 4
Neb Buffer 4, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1096 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/buffer+4/NEBuff+4/pm42854686-911-5-8
Average 98 stars, based on 1096 article reviews

neb buffer 4 - by Bioz Stars, 2026-11

98/100 stars

Images

Plasmid Preparation:

Article Title: Albumin protein variants, production thereof and uses of same
Article Snippet: In each time point, cells were collected and the number of total cells, live cells and % of viable cells were determined automatically using Brightfield Cell Counter DeNovix. .. DNA Restriction. pET29b vector with 900 bp insert was restricted with NcoI and XhoI enzymes (NEB) overnight at 37° C., using the following buffers: rCutsmart buffer (NEB, contains 0.1 mg/ml rBSA), buffer 4 (NEB, identical composition to rCutsmart buffer, but no BSA), and buffer 4 supplemented with HSA1, BSA2, and HSA3 variants (tagless, after gel filtration and ion exchange purification) at 0.1 mg/ml. .. Samples of pET28b(+) vector (1.5 μg) were restricted by BsiEI (10U, NEB) in 15 μl reaction volumes containing the Cutsmart buffer (NEB) or a reconstituted equivalent (50 mM Potassium acetate, 20 mM Tris-acetate, Mg-acetate, pH 7.9) supplemented with 0.lmg/ml of either commercial BSA (Sigma), HSA1, BSA2, or HSA3 variants (tagless, after gel filtration and ion exchange purification) at temperatures of 60-80° C. for 15 min using a gradient PCR (SensoQuest).

Article Title: Scalable transcription factor mapping uncovers the regulatory dynamics of natural and synthetic transcription factors in human T cell states
Article Snippet: Full plasmid sequencing was performed using nanopore sequencing (Plasmidsaurus). .. Resulting DNA was digested for 16 h with NdeI (NEB, R0111L) and RecBCD (NEB, M0345L) in Buffer 4 (NEB, B7004S) supplemented with 1 mM ATP (NEB, P0756S) to remove the parental plasmid and contaminating genomic DNA. .. The PCR reaction consisted of 12.5 μL CloneAmp HiFi PCR Premix (Takara, 639298), 0.75 μL of 10 μM TFlex_SRT_Fw, 0.75 μL of 10 μM TFlex_SRT_Rv, 2 ng of P167 minicircle TFlex SRT-tCD34 vector, 1.25 μL DMSO (Sigma-Aldrich, D2650), and nuclease-free water to 25 μL (see Supplementary Table 8 for vector and primer sequences).

Filtration:

Purification:

Polymerase Chain Reaction:

Article Title: UTR-Insight: integrating deep learning for efficient 5' UTR discovery and design.
Article Snippet: .. The PCR product DNA templates were digested by adding 8.8 μL of PCR product, 1 μL of Cutsmart buffer, and 0.2 μL of Dpn I (NEB), followed by incubation at 37 °C for 30 min and 75 °C for 20 min. For enzyme digestion, 4 μL of the digested product was mixed with 0.5 μL of buffer 4 and 0.5 μL of T5 exonuclease (NEB), and the mixture was incubated on ice for 5 min. .. Transformation was performed by adding 50 μL of DH5α competent cells (TransGen Biotech Co., Ltd) to the enzyme digestion product, incubating on ice for 30 min, heat shocking at 42°C for 45 s, adding 700 μL of LB medium, and shaking at 37°C for 1 h at 220 rpm.

Article Title: UTR-Insight: integrating deep learning for efficient 5′ UTR discovery and design
Article Snippet: .. The PCR product DNA templates were digested by adding 8.8 μL of PCR product, 1 μL of Cutsmart buffer, and 0.2 μL of Dpn I (NEB), followed by incubation at 37 °C for 30 min and 75 °C for 20 min. For enzyme digestion, 4 μL of the digested product was mixed with 0.5 μL of buffer 4 and 0.5 μL of T5 exonuclease (NEB), and the mixture was incubated on ice for 5 min. .. Transformation was performed by adding 50 μL of DH5α competent cells (TransGen Biotech Co., Ltd) to the enzyme digestion product, incubating on ice for 30 min, heat shocking at 42°C for 45 s, adding 700 μL of LB medium, and shaking at 37°C for 1 h at 220 rpm.

Incubation:

Produced:

Article Title: Method of DNA synthesis
Article Snippet: .. Reagents Phusion® High Fidelity DNA polymerase (New England Biolabs), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Protelomerase VP58.5 produced in house (stock concentration 21.5 μM), T5 Exonuclease (New England Biolabs), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), GelRed ss/dsDNA stain (Biotium), 10% TBE precast PAGE gels (ThermoFisher), Low Range (LR) and 1 kb DNA Ladder (New England Biolabs) Isothermal Amplification Buffer (“IAB”, New England Biolabs) comprising at 1×: 20 mM Tris-HCl; 10 mM (NH4)2SO4; 50 mM KCl; 2 mM MgSO4 & 0.1% Tween® 20, Buffer 4 (New England Biolabs) comprising at 1×: 50 mM potassium acetate; 20 mM Tris-acetate; 10 mM magnesium acetate & 1 mM DTT, TBE buffer from 20× stock (Thermofisher). .. TABLE 1 Oligonucleotides (Integrated DNA Technologies) SEQ ID Name Length Description Sequence (5′-3′) NO 1.120 79 nt Initiating oligonucleotide TATCAGCACACAATTGCCCATT 31 primer - Alexa Fluor ® 488 ATACGCGCGTATAATGGACTAT fluorophore linked to the 5′ TGTGTGCTGATATGTACACTTA end.

Review

neb buffer 4 (New England Biolabs)

Structured Review

Images

Related Articles

Plasmid Preparation:

Filtration:

Purification:

Polymerase Chain Reaction:

Incubation:

Produced:

Concentration Assay:

Staining:

Polyacrylamide Gel Electrophoresis:

Amplification:

Similar Products

Image Search Results